|
Left Crispr |
Right Crispr |
Crispr ID |
948247615 |
948247620 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:236499585-236499607
|
2:236499614-236499636
|
Sequence |
CCTCAGGCTAATTTTTGTATTTT |
AGATGGGGGTTTCACCACACTGG |
Strand |
- |
+ |
Off-target summary |
{0: 46, 1: 1016, 2: 1756, 3: 1533, 4: 2484} |
{0: 2, 1: 35, 2: 215, 3: 1458, 4: 2733} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|