|
Left Crispr |
Right Crispr |
| Crispr ID |
948247615 |
948247621 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:236499585-236499607
|
2:236499619-236499641
|
| Sequence |
CCTCAGGCTAATTTTTGTATTTT |
GGGGTTTCACCACACTGGCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 46, 1: 1016, 2: 1756, 3: 1533, 4: 2484} |
{0: 48, 1: 1791, 2: 15271, 3: 95826, 4: 167328} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|