ID: 948377402_948377404

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 948377402 948377404
Species Human (GRCh38) Human (GRCh38)
Location 2:237530522-237530544 2:237530550-237530572
Sequence CCTCAGCTGACTTTTTACTGTAG TCTGGAAGCTTCCTCAACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 204} {0: 1, 1: 0, 2: 2, 3: 20, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!