ID: 948381560_948381567

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 948381560 948381567
Species Human (GRCh38) Human (GRCh38)
Location 2:237553721-237553743 2:237553761-237553783
Sequence CCTCCACATGGACTCCCACCTGC CAGTCCTGCACTGCTCACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 341} {0: 1, 1: 0, 2: 3, 3: 21, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!