ID: 948436642_948436649

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 948436642 948436649
Species Human (GRCh38) Human (GRCh38)
Location 2:237958160-237958182 2:237958206-237958228
Sequence CCGGGGGGGCAGCCTGAGATGGA CATCACTGATGCTCCAAATTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!