ID: 948485354_948485359

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 948485354 948485359
Species Human (GRCh38) Human (GRCh38)
Location 2:238277495-238277517 2:238277529-238277551
Sequence CCAGTACCTGTCTGTTGGCAACT CTCGACAGGGCCTCGTTATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 122} {0: 1, 1: 0, 2: 0, 3: 4, 4: 26}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!