ID: 948506929_948506935

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 948506929 948506935
Species Human (GRCh38) Human (GRCh38)
Location 2:238434811-238434833 2:238434859-238434881
Sequence CCTCCTTCTTTTACTCAGGCTCA CCCATTGCTATTTGCTTCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 322} {0: 1, 1: 0, 2: 1, 3: 13, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!