ID: 948607579_948607588

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 948607579 948607588
Species Human (GRCh38) Human (GRCh38)
Location 2:239145990-239146012 2:239146042-239146064
Sequence CCAGAGAGGCGCTGTGAGAAGGT GGCCTCTGTGCTGTGGCACGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 112} {0: 1, 1: 1, 2: 3, 3: 25, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!