ID: 948811666_948811676

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 948811666 948811676
Species Human (GRCh38) Human (GRCh38)
Location 2:240481561-240481583 2:240481587-240481609
Sequence CCTGTCCTGCACCAGTCCCCTCT TCACCTCGATGGGTTGCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 307} {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!