ID: 948983880_948983890

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 948983880 948983890
Species Human (GRCh38) Human (GRCh38)
Location 2:241508489-241508511 2:241508513-241508535
Sequence CCGCGAAGGCTCCCACCCGCAGC TCTGTTCGCCCGGGGACCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 137} {0: 1, 1: 0, 2: 2, 3: 7, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!