ID: 948988651_948988662

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 948988651 948988662
Species Human (GRCh38) Human (GRCh38)
Location 2:241541077-241541099 2:241541118-241541140
Sequence CCGCTCCGCGCCCGCCCTGCTTG ACCGCTCGCTCGCGACGCCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 3, 4: 9}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!