ID: 949046927_949046941

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 949046927 949046941
Species Human (GRCh38) Human (GRCh38)
Location 2:241876659-241876681 2:241876687-241876709
Sequence CCCAGGAGAAACCCCAATCCAGG AGGGGCCAACTGCAGGGACGAGG
Strand - +
Off-target summary {0: 5, 1: 4, 2: 2, 3: 24, 4: 221} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!