ID: 949048073_949048088

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 949048073 949048088
Species Human (GRCh38) Human (GRCh38)
Location 2:241881421-241881443 2:241881457-241881479
Sequence CCAGAGCCCACCTGGACCCCACA GGTGCGGAGGAGGCCGCTGTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!