ID: 949048073_949048090

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 949048073 949048090
Species Human (GRCh38) Human (GRCh38)
Location 2:241881421-241881443 2:241881461-241881483
Sequence CCAGAGCCCACCTGGACCCCACA CGGAGGAGGCCGCTGTAGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 11, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!