ID: 949070469_949070478

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 949070469 949070478
Species Human (GRCh38) Human (GRCh38)
Location 2:242021331-242021353 2:242021379-242021401
Sequence CCTCGGGGGAGCTGATGTTCCTG TGGTTTGAGGGCCGTGCAGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 59, 3: 160, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!