ID: 949079870_949079889

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 949079870 949079889
Species Human (GRCh38) Human (GRCh38)
Location 2:242088468-242088490 2:242088503-242088525
Sequence CCGCCCCCCCGCGCCCCCGCGCC CGCCCCCACACCTCCACGCCCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 42, 4: 459}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!