ID: 949079875_949079889

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 949079875 949079889
Species Human (GRCh38) Human (GRCh38)
Location 2:242088475-242088497 2:242088503-242088525
Sequence CCCGCGCCCCCGCGCCCCCGCGC CGCCCCCACACCTCCACGCCCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!