ID: 949377129_949377130

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 949377129 949377130
Species Human (GRCh38) Human (GRCh38)
Location 3:3403118-3403140 3:3403154-3403176
Sequence CCAAAATATATAAATAAAACTCA CAAAATAACCCCAAATAACCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 24, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!