ID: 949596465_949596472

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 949596465 949596472
Species Human (GRCh38) Human (GRCh38)
Location 3:5553088-5553110 3:5553135-5553157
Sequence CCAGCCAGTAGCAGGGCACTGGC AACCTGGAATCAAGGATCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 173} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!