ID: 949966759_949966767

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 949966759 949966767
Species Human (GRCh38) Human (GRCh38)
Location 3:9363202-9363224 3:9363233-9363255
Sequence CCTCTTGCAGTTGAGGCCGGCGC ACTTCAGGCGGATCTCGTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 54} {0: 1, 1: 0, 2: 0, 3: 1, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!