ID: 949966761_949966769

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 949966761 949966769
Species Human (GRCh38) Human (GRCh38)
Location 3:9363218-9363240 3:9363258-9363280
Sequence CCGGCGCCGAGCCGGACTTCAGG CCCATCTTGCTCCCTCTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62} {0: 1, 1: 1, 2: 22, 3: 145, 4: 830}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!