ID: 950416674_950416681

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 950416674 950416681
Species Human (GRCh38) Human (GRCh38)
Location 3:12872889-12872911 3:12872909-12872931
Sequence CCCCAACAAAGAGCAGGAACGGG GGGAAGCAAGAAGCAGGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 105} {0: 1, 1: 0, 2: 8, 3: 69, 4: 626}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!