ID: 950416674_950416682

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 950416674 950416682
Species Human (GRCh38) Human (GRCh38)
Location 3:12872889-12872911 3:12872918-12872940
Sequence CCCCAACAAAGAGCAGGAACGGG GAAGCAGGCTGGGGCAAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 105} {0: 1, 1: 1, 2: 9, 3: 44, 4: 483}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!