ID: 950420961_950420963

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 950420961 950420963
Species Human (GRCh38) Human (GRCh38)
Location 3:12899281-12899303 3:12899295-12899317
Sequence CCACTGGGAACGCGGCCCCGCGG GCCCCGCGGCCCGCAGAGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 76} {0: 1, 1: 0, 2: 1, 3: 15, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!