ID: 950466478_950466483

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 950466478 950466483
Species Human (GRCh38) Human (GRCh38)
Location 3:13158323-13158345 3:13158367-13158389
Sequence CCACGTTCAGCAGTTTTCATACC GTGTGTTCTCATTTTGGGTTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!