ID: 950664515_950664525

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 950664515 950664525
Species Human (GRCh38) Human (GRCh38)
Location 3:14487146-14487168 3:14487196-14487218
Sequence CCAGCGGGGGCTCCCTGGGTGAA AAATTGCAACATTCTGGACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 123} {0: 1, 1: 0, 2: 1, 3: 25, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!