ID: 950828683_950828685

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 950828683 950828685
Species Human (GRCh38) Human (GRCh38)
Location 3:15852970-15852992 3:15852986-15853008
Sequence CCTGGTAACTTTTTTTTAAATCA TAAATCAGTATCGCTTAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 89, 4: 872} {0: 1, 1: 0, 2: 0, 3: 13, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!