ID: 950919110_950919114

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 950919110 950919114
Species Human (GRCh38) Human (GRCh38)
Location 3:16676305-16676327 3:16676339-16676361
Sequence CCTTTAAGGAATCAAACTTGACT TAAAACCCCTTTGGAAAAACTGG
Strand - +
Off-target summary {0: 115, 1: 183, 2: 150, 3: 142, 4: 232} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!