|
Left Crispr |
Right Crispr |
Crispr ID |
951352489 |
951352494 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:21623468-21623490
|
3:21623519-21623541
|
Sequence |
CCAGTCTTTACAAGAAAATCAAG |
TGTAGTCTTAGCTAGTCAGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 0, 2: 10, 3: 221, 4: 2857} |
{0: 2, 1: 249, 2: 6312, 3: 64494, 4: 189815} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|