ID: 951416012_951416019

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 951416012 951416019
Species Human (GRCh38) Human (GRCh38)
Location 3:22422337-22422359 3:22422390-22422412
Sequence CCAACTTTTCTACACAAAAGCAG CCAGGGCTCATCTAGACTGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 14, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!