ID: 951440180_951440184

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 951440180 951440184
Species Human (GRCh38) Human (GRCh38)
Location 3:22713587-22713609 3:22713634-22713656
Sequence CCAGAGACTGATGAGTGTGGAGA TGTAGGTTCTTCAGGTGTTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!