ID: 951442932_951442936 |
View in Genome Browser |
Spacer: -6 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 951442932 | 951442936 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 3:22743488-22743510 | 3:22743505-22743527 |
Sequence | CCCGATTTTCCAGGTGCCGTCTG | CGTCTGTCACCCCATTGACTAGG |
Strand | - | + |
Off-target summary | No data | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |