ID: 951442932_951442937

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 951442932 951442937
Species Human (GRCh38) Human (GRCh38)
Location 3:22743488-22743510 3:22743510-22743532
Sequence CCCGATTTTCCAGGTGCCGTCTG GTCACCCCATTGACTAGGAAAGG
Strand - +
Off-target summary {0: 851, 1: 1822, 2: 1444, 3: 755, 4: 543} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!