ID: 951442933_951442937

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 951442933 951442937
Species Human (GRCh38) Human (GRCh38)
Location 3:22743489-22743511 3:22743510-22743532
Sequence CCGATTTTCCAGGTGCCGTCTGT GTCACCCCATTGACTAGGAAAGG
Strand - +
Off-target summary {0: 857, 1: 1702, 2: 1055, 3: 528, 4: 365} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!