ID: 951733432_951733439

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 951733432 951733439
Species Human (GRCh38) Human (GRCh38)
Location 3:25836448-25836470 3:25836492-25836514
Sequence CCAGCTCATGTTCCCCAACACAA ATGAACAAAACTGCCTTTGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 9, 3: 47, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!