ID: 951888969_951888977

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 951888969 951888977
Species Human (GRCh38) Human (GRCh38)
Location 3:27551553-27551575 3:27551585-27551607
Sequence CCTTGGCACAGTGGCCAGATCTC TAGCAAGCTCCTGGGGGAGGAGG
Strand - +
Off-target summary No data {0: 323, 1: 289, 2: 106, 3: 91, 4: 375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!