ID: 951888969_951888980

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 951888969 951888980
Species Human (GRCh38) Human (GRCh38)
Location 3:27551553-27551575 3:27551594-27551616
Sequence CCTTGGCACAGTGGCCAGATCTC CCTGGGGGAGGAGGTTCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 395, 3: 171, 4: 453} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!