ID: 951888969_951888981

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 951888969 951888981
Species Human (GRCh38) Human (GRCh38)
Location 3:27551553-27551575 3:27551603-27551625
Sequence CCTTGGCACAGTGGCCAGATCTC GGAGGTTCTGGAGGAACCCCTGG
Strand - +
Off-target summary No data {0: 70, 1: 279, 2: 240, 3: 151, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!