ID: 951895997_951896004

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 951895997 951896004
Species Human (GRCh38) Human (GRCh38)
Location 3:27610221-27610243 3:27610261-27610283
Sequence CCTCCATCGTCAATGTGTTTACC TTTTATCTGAGGCCTGCTGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 11, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!