ID: 952000275_952000285

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 952000275 952000285
Species Human (GRCh38) Human (GRCh38)
Location 3:28777322-28777344 3:28777370-28777392
Sequence CCATGCTGGGTCATGCGCTTACT GTGACTGGAGGGCTGGTGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 62, 4: 784}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!