ID: 952134404_952134411

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 952134404 952134411
Species Human (GRCh38) Human (GRCh38)
Location 3:30400517-30400539 3:30400552-30400574
Sequence CCAGCTGACAGTATGAAGCCCTT TAGAGCAGGCCAATATGCCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!