ID: 952298755_952298763

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 952298755 952298763
Species Human (GRCh38) Human (GRCh38)
Location 3:32085473-32085495 3:32085526-32085548
Sequence CCATAGGCAGCTTGTGTTAGTCA ACAGAGGCTATCAGTATCCCAGG
Strand - +
Off-target summary {0: 19, 1: 19, 2: 43, 3: 62, 4: 133} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!