ID: 952633034_952633037

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 952633034 952633037
Species Human (GRCh38) Human (GRCh38)
Location 3:35493013-35493035 3:35493064-35493086
Sequence CCAGCAGCTGCAGTCACGTCATC TGCATGCACCTGTTGTTAAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 11, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!