ID: 952647167_952647172

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 952647167 952647172
Species Human (GRCh38) Human (GRCh38)
Location 3:35674532-35674554 3:35674554-35674576
Sequence CCTACCTACAAAACCTGGGTATA ACTTTATCTGGGAATAATGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 126} {0: 1, 1: 0, 2: 0, 3: 7, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!