ID: 952647168_952647174

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 952647168 952647174
Species Human (GRCh38) Human (GRCh38)
Location 3:35674536-35674558 3:35674580-35674602
Sequence CCTACAAAACCTGGGTATACTTT GTGATTTTCTATGTGGCTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 170} {0: 1, 1: 0, 2: 2, 3: 53, 4: 429}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!