ID: 952888898_952888904

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 952888898 952888904
Species Human (GRCh38) Human (GRCh38)
Location 3:38028519-38028541 3:38028550-38028572
Sequence CCATGAACAGTTTAGATGGATGG CACTAAAGCCTCCAACCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 132} {0: 1, 1: 0, 2: 12, 3: 299, 4: 4159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!