ID: 952928044_952928050

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 952928044 952928050
Species Human (GRCh38) Human (GRCh38)
Location 3:38336254-38336276 3:38336298-38336320
Sequence CCTCCTGAATTACGGAGTGTATT GAAAAGTACCACCAACTAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 61} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!