ID: 952978186_952978192

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 952978186 952978192
Species Human (GRCh38) Human (GRCh38)
Location 3:38713984-38714006 3:38713997-38714019
Sequence CCCGCAGTGGCCGCAGAGCGCGA CAGAGCGCGAAGGGTTCGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 144} {0: 1, 1: 0, 2: 0, 3: 0, 4: 23}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!