ID: 953180438_953180442

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 953180438 953180442
Species Human (GRCh38) Human (GRCh38)
Location 3:40589756-40589778 3:40589770-40589792
Sequence CCAAGAGCCCTCTGAGCATGCTG AGCATGCTGGTAGCCCACTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 241} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!