ID: 953225654_953225661

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 953225654 953225661
Species Human (GRCh38) Human (GRCh38)
Location 3:41017051-41017073 3:41017104-41017126
Sequence CCTCTAATGAATGCAGCATTCAA TCACCAGACACCAAACCTGCTGG
Strand - +
Off-target summary No data {0: 33, 1: 277, 2: 676, 3: 1257, 4: 1830}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!